User contributions
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 11:37, 3 October 2016 (diff | hist) . . (+30) . . CrudeDrug:Fossilia Ossis Mastodi (top)
- 11:34, 3 October 2016 (diff | hist) . . (-18) . . CrudeDrug:Longan Arillus (top)
- 11:31, 3 October 2016 (diff | hist) . . (+51) . . CrudeDrug:Coicis Semen
- 11:28, 3 October 2016 (diff | hist) . . (-39) . . CrudeDrug:Leonuri Herba
- 11:27, 3 October 2016 (diff | hist) . . (-106) . . CrudeDrug:Saussureae Radix (top)
- 11:24, 3 October 2016 (diff | hist) . . (-60) . . CrudeDrug:Akebiae Caulis
- 11:21, 3 October 2016 (diff | hist) . . (-10) . . CrudeDrug:Mel (top)
- 11:19, 3 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Mel
- 11:12, 3 October 2016 (diff | hist) . . (-69) . . CrudeDrug:Cannabis Fructus (top)
- 11:10, 3 October 2016 (diff | hist) . . (+39) . . CrudeDrug:Ephedrae Herba (top)
- 11:06, 3 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Ostreae Testa (top)
- 10:57, 3 October 2016 (diff | hist) . . (+15) . . CrudeDrug:Moutan Cortex
- 10:51, 3 October 2016 (diff | hist) . . (+30) . . CrudeDrug:Saposhnikoviae Radix (top)
- 10:47, 3 October 2016 (diff | hist) . . (+25) . . CrudeDrug:Natrii Sulfus (top)
- 10:41, 3 October 2016 (diff | hist) . . (-49) . . CrudeDrug:Sinomeni Caulis et Rhizoma (top)
- 10:39, 3 October 2016 (diff | hist) . . (+54) . . CrudeDrug:Processi Aconiti Radix
- 10:33, 3 October 2016 (diff | hist) . . (-75) . . CrudeDrug:Poria (top)
- 10:30, 3 October 2016 (diff | hist) . . (-63) . . CrudeDrug:Arecae Semen (top)
- 10:24, 3 October 2016 (diff | hist) . . (-3) . . CrudeDrug:Eriobotryae Folium
- 10:19, 3 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Angelicae dahuricae Radix (top)
- 10:17, 3 October 2016 (diff | hist) . . (-27) . . CrudeDrug:Lilii Bulbus (top)
- 10:15, 3 October 2016 (diff | hist) . . (-54) . . CrudeDrug:Pinelliae Tuber (top)
- 10:10, 3 October 2016 (diff | hist) . . (-57) . . CrudeDrug:Menthae Herba
- 10:07, 3 October 2016 (diff | hist) . . (-54) . . CrudeDrug:Ophiopogonis Tuber (top)
- 10:02, 3 October 2016 (diff | hist) . . (+25) . . CrudeDrug:Hordei Fructus Germinatus (top)
- 10:00, 3 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Fritillariae Bulbus
- 09:58, 3 October 2016 (diff | hist) . . (-45) . . CrudeDrug:Lonicerae Folium cum Caulis (top)
- 09:53, 3 October 2016 (diff | hist) . . (-255) . . CrudeDrug:Ginseng Radix (top)
- 09:50, 3 October 2016 (diff | hist) . . (+33) . . CrudeDrug:Eucommiae Cortex (top)
- 09:48, 3 October 2016 (diff | hist) . . (+18) . . CrudeDrug:Aralia cordata Rhizoma
- 09:43, 3 October 2016 (diff | hist) . . (-33) . . CrudeDrug:Persicae Semen
- 15:30, 30 September 2016 (diff | hist) . . (+66) . . CrudeDrug:Angelicae Radix
- 15:25, 30 September 2016 (diff | hist) . . (-27) . . CrudeDrug:Benincasae Semen
- 15:07, 30 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Asparagi Tuber (top)
- 15:03, 30 September 2016 (diff | hist) . . (0) . . CrudeDrug:Gastrodiae Tuber (top)
- 14:40, 30 September 2016 (diff | hist) . . (+25) . . CrudeDrug:Arisaematis Rhizoma (top)
- 14:15, 30 September 2016 (diff | hist) . . (+15) . . CrudeDrug:Aurantii Nobilis Pericarpium (top)
- 14:13, 30 September 2016 (diff | hist) . . (-33) . . CrudeDrug:Polyporus (top)
- 14:10, 30 September 2016 (diff | hist) . . (-21) . . CrudeDrug:Uncariae Uncis cum Ramulus (top)
- 14:06, 30 September 2016 (diff | hist) . . (-102) . . CrudeDrug:Caryophylli Flos (top)
- 14:02, 30 September 2016 (diff | hist) . . (+19) . . CrudeDrug:Camelliae Folium (top)
- 13:56, 30 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Anemarrhenae Rhizoma (top)
- 13:51, 30 September 2016 (diff | hist) . . (-90) . . CrudeDrug:Alismatis Rhizoma (top)
- 13:45, 30 September 2016 (diff | hist) . . (-72) . . CrudeDrug:Zizyphi Fructus (top)
- 13:37, 30 September 2016 (diff | hist) . . (-72) . . CrudeDrug:Rhei Rhizoma (top)
- 13:31, 30 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Perillae Herba
- 13:25, 30 September 2016 (diff | hist) . . (-15) . . CrudeDrug:Sappan Lignum
- 13:22, 30 September 2016 (diff | hist) . . (-21) . . CrudeDrug:Mori Cortex (top)
- 13:16, 30 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Atractylodis Rhizoma (top)
- 13:12, 30 September 2016 (diff | hist) . . (+6) . . CrudeDrug:Atractylodis lanceae Rhizoma (top)
- 10:45, 30 September 2016 (diff | hist) . . (+55) . . CrudeDrug:Cicadae Periostracum (top)
- 10:42, 30 September 2016 (diff | hist) . . (+21) . . CrudeDrug:Nupharis Rhizoma
- 10:38, 30 September 2016 (diff | hist) . . (+9) . . CrudeDrug:Peucedani Radix (top)
- 10:34, 30 September 2016 (diff | hist) . . (+45) . . CrudeDrug:Cnidii Rhizoma
- 09:53, 30 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Gypsum Fibrosum (top)
- 09:49, 30 September 2016 (diff | hist) . . (+18) . . CrudeDrug:Oryzae Fructus
- 09:47, 30 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Oryzae Fructus
- 14:29, 28 September 2016 (diff | hist) . . (+27) . . CrudeDrug:Magnoliae Flos (top)
- 14:13, 28 September 2016 (diff | hist) . . (+24) . . CrudeDrug:Cimicifugae Rhizoma
- 13:56, 28 September 2016 (diff | hist) . . (-33) . . CrudeDrug:Zingiberis Rhizoma
- 13:51, 28 September 2016 (diff | hist) . . (-39) . . CrudeDrug:Zingiberis Processum Rhizoma
- 13:49, 28 September 2016 (diff | hist) . . (-117) . . CrudeDrug:Zingiberis Rhizoma
- 13:38, 28 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Amomi Semen (top)
- 13:35, 28 September 2016 (diff | hist) . . (-15) . . CrudeDrug:Plantaginis Semen (top)
- 13:32, 28 September 2016 (diff | hist) . . (-135) . . CrudeDrug:Paeoniae Radix
- 13:30, 28 September 2016 (diff | hist) . . (-75) . . CrudeDrug:Tribuli Fructus (top)
- 13:28, 28 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Lithospermi Radix (top)
- 13:25, 28 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Lycii Cortex (top)
- 13:23, 28 September 2016 (diff | hist) . . (-102) . . CrudeDrug:Rehmanniae Radix (top)
- 13:20, 28 September 2016 (diff | hist) . . (-66) . . CrudeDrug:Dioscoreae Rhizoma (top)
- 13:17, 28 September 2016 (diff | hist) . . (-39) . . CrudeDrug:Zizyphi Semen (top)
- 15:23, 26 September 2016 (diff | hist) . . (-45) . . CrudeDrug:Zanthoxyli Fructus (top)
- 15:21, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Corni Fructus (top)
- 15:20, 26 September 2016 (diff | hist) . . (+33) . . CrudeDrug:Gardeniae Fructus (top)
- 15:12, 26 September 2016 (diff | hist) . . (-30) . . CrudeDrug:Crataegi Fructus
- 15:11, 26 September 2016 (diff | hist) . . (+54) . . CrudeDrug:Crocus
- 15:09, 26 September 2016 (diff | hist) . . (-27) . . CrudeDrug:Asiasari Radix
- 15:06, 26 September 2016 (diff | hist) . . (+9) . . CrudeDrug:Bupleuri Radix
- 14:59, 26 September 2016 (diff | hist) . . (-150) . . CrudeDrug:Schisandrae Fructus (top)
- 14:56, 26 September 2016 (diff | hist) . . (0) . . CrudeDrug:Sesami Semen (top)
- 14:55, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Arctii Fructus (top)
- 14:52, 26 September 2016 (diff | hist) . . (-57) . . CrudeDrug:Evodiae Fructus
- 14:49, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Achyranthis Radix
- 14:46, 26 September 2016 (diff | hist) . . (-105) . . CrudeDrug:Magnoliae Cortex (top)
- 14:44, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Oryzae Fructus
- 14:42, 26 September 2016 (diff | hist) . . (-15) . . CrudeDrug:Cyperi Rhizoma
- 14:39, 26 September 2016 (diff | hist) . . (+3) . . CrudeDrug:Carthami Flos
- 14:32, 26 September 2016 (diff | hist) . . (-54) . . CrudeDrug:Koi
- 14:27, 26 September 2016 (diff | hist) . . (-141) . . CrudeDrug:Cinnamomi Cortex
- 14:22, 26 September 2016 (diff | hist) . . (-27) . . CrudeDrug:Schizonepetae Spica
- 14:20, 26 September 2016 (diff | hist) . . (-22) . . CrudeDrug:Sophorae Radix (top)
- 14:16, 26 September 2016 (diff | hist) . . (-63) . . CrudeDrug:Armeniacae Semen (top)
- 14:13, 26 September 2016 (diff | hist) . . (-66) . . CrudeDrug:Notopterygii Rhizoma
- 14:07, 26 September 2016 (diff | hist) . . (-147) . . CrudeDrug:Aurantii Fructus Immaturus (top)
- 14:05, 26 September 2016 (diff | hist) . . (-60) . . CrudeDrug:Chrysanthemi Flos
- 14:03, 26 September 2016 (diff | hist) . . (-117) . . CrudeDrug:Platycodi Radix (top)
- 13:56, 26 September 2016 (diff | hist) . . (+42) . . CrudeDrug:Glycyrrhizae Radix (top)
- 13:52, 26 September 2016 (diff | hist) . . (+34) . . CrudeDrug:Trichosanthis Semen (top)
- 13:49, 26 September 2016 (diff | hist) . . (-54) . . CrudeDrug:Trichosanthis Radix (top)
- 13:46, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Kasseki (top)
- 13:43, 26 September 2016 (diff | hist) . . (-72) . . CrudeDrug:Puerariae Radix (top)
- 13:41, 26 September 2016 (diff | hist) . . (-63) . . CrudeDrug:Polygoni multiflori Radix (top)
- 13:38, 26 September 2016 (diff | hist) . . (+25) . . CrudeDrug:Artemisiae Folium (top)
- 13:33, 26 September 2016 (diff | hist) . . (0) . . Persist:CrudeDrugList
- 13:33, 26 September 2016 (diff | hist) . . (+118) . . Persist:CrudeDrugList
- 13:44, 20 September 2016 (diff | hist) . . (-36) . . CrudeDrug:Polygalae Radix (top)
- 13:41, 20 September 2016 (diff | hist) . . (-102) . . CrudeDrug:Coptidis Rhizoma (top)
- 13:35, 20 September 2016 (diff | hist) . . (-21) . . CrudeDrug:Quercus Cortex (top)
- 13:30, 20 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Asini Corii Collas
- 13:27, 20 September 2016 (diff | hist) . . (0) . . CrudeDrug:Pruni Cortex (top)
- 13:16, 20 September 2016 (diff | hist) . . (+16) . . CrudeDrug:Pruni Cortex
- 13:14, 20 September 2016 (diff | hist) . . (-36) . . CrudeDrug:Phellodendri Cortex (top)
- 11:32, 20 September 2016 (diff | hist) . . (-162) . . CrudeDrug:Scutellariae Radix (top)
- 11:28, 20 September 2016 (diff | hist) . . (-135) . . CrudeDrug:Astragali Radix (top)
- 11:25, 20 September 2016 (diff | hist) . . (+15) . . CrudeDrug:Corydalis Tuber (top)
- 11:20, 20 September 2016 (diff | hist) . . (-84) . . CrudeDrug:Linderae Radix (top)
- 11:18, 20 September 2016 (diff | hist) . . (-84) . . CrudeDrug:Foeniculi Fructus (top)
- 11:14, 20 September 2016 (diff | hist) . . (+17) . . CrudeDrug:Asini Corii Collas
- 11:10, 20 September 2016 (diff | hist) . . (-153) . . CrudeDrug:Artemisiae capillaris Flos (top)
- 11:01, 20 September 2016 (diff | hist) . . (-14) . . CrudeDrug:Asini Corii Collas
- 11:01, 20 September 2016 (diff | hist) . . (+16) . . CrudeDrug:Asini Corii Collas
- 10:01, 20 September 2016 (diff | hist) . . (+30) . . CrudeDrug:Clematidis Radix (top)
- 01:33, 4 July 2015 (diff | hist) . . (0) . . User:Aritalab/Kazuhiro Takemoto (top)
- 01:32, 4 July 2015 (diff | hist) . . (+9) . . User:Aritalab/Kazuhiro Takemoto
- 01:31, 4 July 2015 (diff | hist) . . (+77) . . User:Aritalab/Kazuhiro Takemoto
- 15:05, 31 December 2014 (diff | hist) . . (+381) . . N SNP:Test (Created page with "@HD VN:1.5 SO:coordinate @SQ SN:test LN:45 r001 163 test 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG * r002 0 test 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA * r003 0 test 9 30 5S6M *...") (top)
- 14:42, 31 December 2014 (diff | hist) . . (+92) . . N JBrowseTest (Created page with "{{#includejs:JBrowse.js|Test}} <div id="GenomeBrowser" style="width: 600px; height: 400px">") (top)
- 14:34, 31 December 2014 (diff | hist) . . (+381) . . N SAM:Test (Created page with "@HD VN:1.5 SO:coordinate @SQ SN:test LN:45 r001 163 test 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG * r002 0 test 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA * r003 0 test 9 30 5S6M *...") (top)
- 14:31, 31 December 2014 (diff | hist) . . (+51) . . N FASTA:Test (Created page with ">test AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT") (top)
- 12:27, 26 September 2014 (diff | hist) . . (-9,713) . . Mol:Test (top)
- 12:27, 26 September 2014 (diff | hist) . . (0) . . File:Testn.png (Editor uploaded a new version of "File:Testn.png") (top)
- 12:27, 26 September 2014 (diff | hist) . . (0) . . File:Test.png (Editor uploaded a new version of "File:Test.png") (top)
- 17:28, 13 July 2014 (diff | hist) . . (+42) . . User:Aritalab (→{{Bilingual|過去のメンバー|Alumni}})
- 21:34, 25 March 2014 (diff | hist) . . (+82) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA)) (top)
- 21:27, 25 March 2014 (diff | hist) . . (+9) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 20:13, 25 March 2014 (diff | hist) . . (-88) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:27, 25 March 2014 (diff | hist) . . (-12) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:27, 25 March 2014 (diff | hist) . . (+100) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:24, 25 March 2014 (diff | hist) . . (+30) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:21, 25 March 2014 (diff | hist) . . (+82) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:19, 25 March 2014 (diff | hist) . . (+1,099) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 11:47, 10 February 2014 (diff | hist) . . (+78) . . Template:AtMet (top)
- 11:00, 7 February 2014 (diff | hist) . . (+474) . . N AtMet:Gamma-Tocopherol::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+441) . . N AtMet:Gamma-Glutamyl-L-cysteine (top)
- 11:00, 7 February 2014 (diff | hist) . . (+400) . . N AtMet:Gamma-Carotene (top)
- 11:00, 7 February 2014 (diff | hist) . . (+481) . . N AtMet:Octadecanoic acid (top)
- 11:00, 7 February 2014 (diff | hist) . . (+426) . . N AtMet:Galactono-1,4-lactone (top)
- 11:00, 7 February 2014 (diff | hist) . . (+365) . . N AtMet:Epicatechin trimer (top)
- 11:00, 7 February 2014 (diff | hist) . . (+394) . . N AtMet:Fucose (top)
- 11:00, 7 February 2014 (diff | hist) . . (+406) . . N AtMet:Formylkynurenine (top)
- 11:00, 7 February 2014 (diff | hist) . . (+394) . . N AtMet:Feruloyl-CoA (top)
- 11:00, 7 February 2014 (diff | hist) . . (+434) . . N AtMet:Farnesyl diphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+372) . . N AtMet:5,4-dimethoxyflavone (top)
- 11:00, 7 February 2014 (diff | hist) . . (+402) . . N AtMet:Ethylene glycol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+378) . . N AtMet:Ethylene (top)
- 11:00, 7 February 2014 (diff | hist) . . (+386) . . N AtMet:Erythrose (top)
- 11:00, 7 February 2014 (diff | hist) . . (+386) . . N AtMet:Episterol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+396) . . N AtMet:Ent-Kaurenol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+407) . . N AtMet:Ent-Kaur-16-ene (top)
- 11:00, 7 February 2014 (diff | hist) . . (+407) . . N AtMet:Ent-Copalyl diphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+472) . . N AtMet:Ent-7alpha-Hydroxykaur-16-en-19-oic acid (top)
- 11:00, 7 February 2014 (diff | hist) . . (+394) . . N AtMet:Eicosan-1-ol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+407) . . N AtMet:DTDP-L-rhamnose (top)
- 11:00, 7 February 2014 (diff | hist) . . (+362) . . N AtMet:4-MethylUmbelliferone - Dimer (top)
- 11:00, 7 February 2014 (diff | hist) . . (+408) . . N AtMet:DTDP-D-glucose (top)
- 11:00, 7 February 2014 (diff | hist) . . (+443) . . N AtMet:Ribulose 1,5-bisphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+486) . . N AtMet:Dotriacontanoic acid::2 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+413) . . N AtMet:Myo-Inositol 1-phosphate::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+455) . . N AtMet:Myo-Inositol 1,4-bisphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+460) . . N AtMet:Myo-Inositol 1,4,5-triphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+422) . . N AtMet:Mannose 6-phosphate::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+423) . . N AtMet:Mannose 1-phosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+386) . . N AtMet:Mannitol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+436) . . N AtMet:Dimethylallyl diphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+379) . . N AtMet:4-MethylUmbelliferone (top)
- 11:00, 7 February 2014 (diff | hist) . . (+465) . . N AtMet:Dihydrozeatin-9-glucoside-O-glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+472) . . N AtMet:Dihydrozeatin riboside-5'-monophosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+420) . . N AtMet:Dihydrozeatin riboside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+428) . . N AtMet:Dihydrozeatin O-glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+401) . . N AtMet:Dihydrozeatin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+422) . . N AtMet:Dihydrosirohydrochlorin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+453) . . N AtMet:Dihydroneopterin triphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+410) . . N AtMet:Dihydroneopterin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+430) . . N AtMet:Dihydrodipicolinic acid (top)
- 11:00, 7 February 2014 (diff | hist) . . (+400) . . N AtMet:Dihomomethionine (top)
- 11:00, 7 February 2014 (diff | hist) . . (+377) . . N AtMet:F(4-O-b)G related metaboliteNum4 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+457) . . N AtMet:Dihidrozeatin riboside-O-glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+452) . . N AtMet:Glyceraldehyde 3-phosphate::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+413) . . N AtMet:Galacturonic acid::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+441) . . N AtMet:Fructose 2,6-bisphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+466) . . N AtMet:Fructose 1,6-bisphosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+424) . . N AtMet:Fructose::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+432) . . N AtMet:Desulfobenzylglucosinolate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+476) . . N AtMet:Erythro-Imidazolylglycerol phosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+440) . . N AtMet:Deoxy phytoprostane J1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+408) . . N AtMet:Delta-Tocopherol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+484) . . N AtMet:1-O-b-D-glucopyranosyl sinapate::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+400) . . N AtMet:Delta-Carotene (top)
- 11:00, 7 February 2014 (diff | hist) . . (+415) . . N AtMet:Delta7-Avenasterol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+454) . . N AtMet:Delta1-Pyrroline-5-carboxylate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+507) . . N AtMet:Dehydroascorbate::2 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+454) . . N AtMet:Capric acid::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+419) . . N AtMet:D-Cysteine (top)
- 11:00, 7 February 2014 (diff | hist) . . (+401) . . N AtMet:D-Coenzyme A (top)
- 11:00, 7 February 2014 (diff | hist) . . (+404) . . N AtMet:Cystathionine (top)
- 11:00, 7 February 2014 (diff | hist) . . (+400) . . N AtMet:Cycloeucalenol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+468) . . N AtMet:Cyanidin 3-sambubioside-5-glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+382) . . N AtMet:4-Methylpentyl glucosinolate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+620) . . N AtMet:Cyanidin 3-O- (2''-O-(xylosyl)-6''-O-(p-O-(glucosyl)-p-coumaroyl) glucoside) 5-O-glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+596) . . N AtMet:Cyanidin 3-O- (2''-O-(xylosyl)-6''-O-(p-coumaroyl) glucoside) 5-O-malonylglucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+566) . . N AtMet:Cyanidin 3-O- (2''-O-(xylosyl) glucoside) 5-O-(6'''-O-malonyl) glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+677) . . N AtMet:Cyanidin 3-O- (2''-O-(xylosyl) 6''-O-(p-O-(glucosyl) p-coumaroyl) glucoside) 5-O- (6'''-O-(malonyl) glucoside) (top)
- 11:00, 7 February 2014 (diff | hist) . . (+854) . . N AtMet:Cyanidin 3-O- (2-O-(2-O-(sinapoyl)-bata-D-xylopyranosyl) 6-O-(4-O-(beta-D-glucopyranosyl)-p-coumaroyl-bata-D-glucopyranoside) 5-O- (6-O-(malonyl) bata-D-glucopyranoside) (top)
- 11:00, 7 February 2014 (diff | hist) . . (+569) . . N AtMet:Cyanidin 3-O- (2''-O-(2'''-O-(sinapoyl) xylosyl) glucoside) 5-O-glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+674) . . N AtMet:Cyanidin 3-O- (2''-O-(2'''-O-(sinapoyl) xylosyl) 6''-O-(p-O-(glucosyl) p-coumaroyl) glucoside) 5-O-glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+629) . . N AtMet:Cyanidin 3-O- (2''-O-(2'''-O-(sinapoyl) xylosyl) 6''-O-(p-coumaroyl) glucoside) 5-O-glucoside (top)
- 11:00, 7 February 2014 (diff | hist) . . (+384) . . N AtMet:Cyanidin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+416) . . N AtMet:Coproporphyrinogen III (top)
- 11:00, 7 February 2014 (diff | hist) . . (+382) . . N AtMet:4-Methylcholesta-8,24-dien-3-ol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+411) . . N AtMet:Coniferyl alcohol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+459) . . N AtMet:Coniferin::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+407) . . N AtMet:Coniferaldehyde (top)
- 11:00, 7 February 2014 (diff | hist) . . (+400) . . N AtMet:Coenzyme A (top)
- 11:00, 7 February 2014 (diff | hist) . . (+404) . . N AtMet:Citramalic acid::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+454) . . N AtMet:Cis-Zeatin riboside monophosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+393) . . N AtMet:Cis-Zeatin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+409) . . N AtMet:Cis-Aconitic acid::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+437) . . N AtMet:Cis-10-Pentadecenoic acid (top)
- 11:00, 7 February 2014 (diff | hist) . . (+412) . . N AtMet:Cis,trans-Xanthoxin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+363) . . N AtMet:4-Hydroy-n-butyl-glucosinolate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+401) . . N AtMet:Chorismic acid (top)
- 11:00, 7 February 2014 (diff | hist) . . (+379) . . N AtMet:Choline::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+414) . . N AtMet:Chlorophyllide a (top)
- 11:00, 7 February 2014 (diff | hist) . . (+398) . . N AtMet:CDP-choline (top)
- 11:00, 7 February 2014 (diff | hist) . . (+398) . . N AtMet:Caulilexin C (top)
- 11:00, 7 February 2014 (diff | hist) . . (+399) . . N AtMet:Cathasterone (top)
- 11:00, 7 February 2014 (diff | hist) . . (+398) . . N AtMet:Castasterone (top)
- 11:00, 7 February 2014 (diff | hist) . . (+416) . . N AtMet:Carbamoyl phosphate (top)
- 11:00, 7 February 2014 (diff | hist) . . (+400) . . N AtMet:Caprylic acid (top)
- 11:00, 7 February 2014 (diff | hist) . . (+410) . . N AtMet:Canthaxanthin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+476) . . N AtMet:3-Hydroxypropyl glucosinolate::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+419) . . N AtMet:Campestanol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+390) . . N AtMet:Camalexin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+395) . . N AtMet:Caffeyl alcohol (top)
- 11:00, 7 February 2014 (diff | hist) . . (+404) . . N AtMet:Caffeoyl-CoA (top)
- 11:00, 7 February 2014 (diff | hist) . . (+419) . . N AtMet:Caffeic aldehyde (top)
- 11:00, 7 February 2014 (diff | hist) . . (+389) . . N AtMet:Cadaverine (top)
- 11:00, 7 February 2014 (diff | hist) . . (+392) . . N AtMet:Brassitin (top)
- 11:00, 7 February 2014 (diff | hist) . . (+398) . . N AtMet:Brassinolide (top)
- 11:00, 7 February 2014 (diff | hist) . . (+389) . . N AtMet:Botrydial (top)
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)