User contributions
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 09:26, 25 October 2018 (diff | hist) . . (+287) . . Lipoquality:SampleType (top)
- 14:36, 30 March 2017 (diff | hist) . . (+31) . . Lipoquality:LipidClass
- 14:35, 30 March 2017 (diff | hist) . . (-544) . . Lipoquality:SampleType
- 14:35, 30 March 2017 (diff | hist) . . (+459) . . Lipoquality:SampleSource
- 15:02, 14 March 2017 (diff | hist) . . (-3) . . Index:PlantSpecies/APG-IV (top)
- 14:47, 14 March 2017 (diff | hist) . . (+14) . . Index:PlantSpecies/APG-IV
- 14:45, 14 March 2017 (diff | hist) . . (+42) . . Index:PlantSpecies/APG-IV
- 14:37, 14 March 2017 (diff | hist) . . (+2) . . Index:PlantSpecies/APG-IV
- 14:35, 14 March 2017 (diff | hist) . . (+6) . . Index:PlantSpecies/APG-IV
- 14:33, 14 March 2017 (diff | hist) . . (+2) . . Index:PlantSpecies/APG-IV
- 14:19, 14 March 2017 (diff | hist) . . (-1) . . Index:PlantSpecies/APG-IV
- 14:15, 14 March 2017 (diff | hist) . . (+1,471) . . Index:PlantSpecies/APG-IV
- 12:04, 14 March 2017 (diff | hist) . . (+636) . . Index:PlantSpecies/APG-IV
- 16:39, 13 March 2017 (diff | hist) . . (0) . . Index:PlantSpecies/APG-IV
- 16:38, 13 March 2017 (diff | hist) . . (+1,045) . . Index:PlantSpecies/APG-IV
- 15:08, 13 March 2017 (diff | hist) . . (-1) . . Index:PlantSpecies/APG-IV
- 15:07, 13 March 2017 (diff | hist) . . (+1) . . Index:PlantSpecies/APG-IV
- 15:05, 13 March 2017 (diff | hist) . . (+1,061) . . Index:PlantSpecies/APG-IV
- 11:34, 13 March 2017 (diff | hist) . . (+6,403) . . Index:PlantSpecies/APG-IV
- 09:12, 13 March 2017 (diff | hist) . . (+212) . . Lipoquality:LipidClass
- 08:55, 13 March 2017 (diff | hist) . . (+35) . . m Lipoquality:SampleType
- 08:54, 13 March 2017 (diff | hist) . . (+776) . . Lipoquality:SampleType
- 08:48, 13 March 2017 (diff | hist) . . (+8) . . Lipoquality:SampleSource
- 15:42, 10 March 2017 (diff | hist) . . (+1) . . Index:PlantSpecies/APG-IV
- 15:41, 10 March 2017 (diff | hist) . . (+1,826) . . Index:PlantSpecies/APG-IV
- 14:02, 10 March 2017 (diff | hist) . . (-18) . . Index:PlantSpecies/APG-IV (→Independent lineage: unplaced to more inclusive clade 独立した系統)
- 14:01, 10 March 2017 (diff | hist) . . (+501) . . Index:PlantSpecies/APG-IV (→Monocots)
- 13:59, 10 March 2017 (diff | hist) . . (+34) . . Index:PlantSpecies/APG-IV (→Independent lineage: unplaced to more inclusive clade)
- 13:45, 10 March 2017 (diff | hist) . . (+25) . . Index:PlantSpecies/APG-IV (→Monocots)
- 13:44, 10 March 2017 (diff | hist) . . (+275) . . Index:PlantSpecies/APG-IV (→Monocots)
- 13:40, 10 March 2017 (diff | hist) . . (+173) . . Index:PlantSpecies/APG-IV (→Monocots)
- 12:18, 10 March 2017 (diff | hist) . . (+59) . . Index:PlantSpecies/APG-IV (→Monocots)
- 12:05, 10 March 2017 (diff | hist) . . (+87) . . Index:PlantSpecies/APG-IV (→Monocots)
- 12:00, 10 March 2017 (diff | hist) . . (+518) . . Index:PlantSpecies/APG-IV (→Monocots)
- 11:42, 10 March 2017 (diff | hist) . . (+409) . . Index:PlantSpecies/APG-IV (→Monocots)
- 11:27, 10 March 2017 (diff | hist) . . (+167) . . Index:PlantSpecies/APG-IV (→Monocots)
- 11:22, 10 March 2017 (diff | hist) . . (+37) . . Index:PlantSpecies/APG-IV (→Monocots)
- 10:57, 10 March 2017 (diff | hist) . . (+114) . . Index:PlantSpecies/APG-IV (→Monocots)
- 10:52, 10 March 2017 (diff | hist) . . (+102) . . Index:PlantSpecies/APG-IV (→Monocots)
- 10:44, 10 March 2017 (diff | hist) . . (0) . . Index:PlantSpecies/APG-IV (→Magnoliids モクレン類)
- 10:39, 10 March 2017 (diff | hist) . . (0) . . Index:PlantSpecies/APG-IV (→Magnoliids モクレン類)
- 10:33, 10 March 2017 (diff | hist) . . (+563) . . Index:PlantSpecies/APG-IV (→Monocots)
- 10:12, 10 March 2017 (diff | hist) . . (+68) . . Index:PlantSpecies/APG-IV (→Independent lineage: unplaced to more inclusive clade)
- 17:04, 9 March 2017 (diff | hist) . . (+121) . . Index:PlantSpecies/APG-IV (→Magnoliids モクレン類)
- 17:02, 9 March 2017 (diff | hist) . . (+614) . . Index:PlantSpecies/APG-IV (→Magnoliids モクレン類)
- 16:30, 9 March 2017 (diff | hist) . . (0) . . Index:PlantSpecies/APG-IV (→Basal angiosperms 基部被子植物)
- 16:29, 9 March 2017 (diff | hist) . . (+201) . . Index:PlantSpecies/APG-IV (→Basal angiosperms 基部被子植物)
- 16:20, 9 March 2017 (diff | hist) . . (+35) . . Index:PlantSpecies/APG-IV (→Basal angiosperms 基部被子植物)
- 09:03, 1 December 2016 (diff | hist) . . (+71) . . Lipoquality:Top (top)
- 11:43, 25 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Moutan Cortex (top)
- 11:40, 25 October 2016 (diff | hist) . . (-27) . . CrudeDrug:Eriobotryae Folium (top)
- 11:30, 25 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Schizonepetae Spica (top)
- 11:27, 25 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Notopterygii Rhizoma (top)
- 11:24, 25 October 2016 (diff | hist) . . (-24) . . CrudeDrug:Forsythiae Fructus (top)
- 11:23, 25 October 2016 (diff | hist) . . (+30) . . CrudeDrug:Akebiae Caulis (top)
- 15:48, 17 October 2016 (diff | hist) . . (0) . . N File:Loading.gif (top)
- 14:39, 17 October 2016 (diff | hist) . . (+1,553) . . N Lipoquality:Database (Created page with "{{#includejs:Lipoquality.js}} {{#formtag:form|method="post" action="/wiki/Lipoquality:Search"| <table> <tr> <td>Sample source<br />{{#formtag:select|name="samplesource" id="s...")
- 14:39, 17 October 2016 (diff | hist) . . (+69) . . N Lipoquality:LipidClass (Created page with "* PC * PE * PG * PI * PS * LPC * LPE * LPG * LPI * LPS * MG * DG * TG")
- 14:39, 17 October 2016 (diff | hist) . . (+22) . . N Lipoquality:SampleSource (Created page with "* Cell * Human * Mouse")
- 14:38, 17 October 2016 (diff | hist) . . (+241) . . N Lipoquality:SampleType (Created page with "* Cell_3T_Wild_P * Cell_HEK_Wild_N * Cell_HEK_Wild_P * Cell_3T_Wild_N * Human_Plasma_Wild_P * Human_Plasma_Wild_N * Mouse_Brain_Wild_N * Mouse_Brain_Wild_P * Mouse_Liver_Wild_...")
- 14:38, 17 October 2016 (diff | hist) . . (+855) . . N Lipoquality:Top (Created page with "<h1>Lipoquality</h1> <p> 説明 </p> <table style="width:100%"> <tr style="width:50%;vertical-align:top;padding-left:0.2em"> <td> <h2 style="font-size:100%;text-align:l...")
- 11:21, 7 October 2016 (diff | hist) . . (+18) . . CrudeDrug:Alpiniae officinari Rhizoma (top)
- 11:19, 7 October 2016 (diff | hist) . . (+21) . . CrudeDrug:Coicis Semen (top)
- 11:18, 7 October 2016 (diff | hist) . . (+21) . . CrudeDrug:Leonuri Herba (top)
- 11:16, 7 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Moutan Cortex
- 11:13, 7 October 2016 (diff | hist) . . (-15) . . CrudeDrug:Processi Aconiti Radix (top)
- 11:11, 7 October 2016 (diff | hist) . . (+18) . . CrudeDrug:Eriobotryae Folium
- 11:09, 7 October 2016 (diff | hist) . . (-36) . . CrudeDrug:Menthae Herba (top)
- 11:07, 7 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Fritillariae Bulbus (top)
- 11:05, 7 October 2016 (diff | hist) . . (-12) . . CrudeDrug:Aralia cordata Rhizoma (top)
- 11:04, 7 October 2016 (diff | hist) . . (-6) . . CrudeDrug:Persicae Semen (top)
- 11:02, 7 October 2016 (diff | hist) . . (-15) . . CrudeDrug:Angelicae Radix (top)
- 11:00, 7 October 2016 (diff | hist) . . (+36) . . CrudeDrug:Benincasae Semen (top)
- 10:55, 7 October 2016 (diff | hist) . . (+18) . . CrudeDrug:Perillae Herba (top)
- 10:54, 7 October 2016 (diff | hist) . . (+21) . . CrudeDrug:Sappan Lignum (top)
- 10:33, 7 October 2016 (diff | hist) . . (+24) . . CrudeDrug:Nupharis Rhizoma (top)
- 10:31, 7 October 2016 (diff | hist) . . (-6) . . CrudeDrug:Cnidii Rhizoma (top)
- 10:26, 7 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Cimicifugae Rhizoma (top)
- 10:25, 7 October 2016 (diff | hist) . . (+25) . . CrudeDrug:Tritici Fructus (top)
- 10:23, 7 October 2016 (diff | hist) . . (+18) . . CrudeDrug:Zingiberis Processum Rhizoma (top)
- 10:15, 7 October 2016 (diff | hist) . . (+33) . . CrudeDrug:Zingiberis Rhizoma (top)
- 10:13, 7 October 2016 (diff | hist) . . (+42) . . CrudeDrug:Paeoniae Radix (top)
- 10:08, 7 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Crataegi Fructus (top)
- 10:08, 7 October 2016 (diff | hist) . . (-18) . . CrudeDrug:Crocus (top)
- 10:06, 7 October 2016 (diff | hist) . . (+18) . . CrudeDrug:Asiasari Radix (top)
- 10:02, 7 October 2016 (diff | hist) . . (+18) . . CrudeDrug:Bupleuri Radix (top)
- 09:59, 7 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Evodiae Fructus (top)
- 09:57, 7 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Achyranthis Radix (top)
- 09:55, 7 October 2016 (diff | hist) . . (+15) . . CrudeDrug:Oryzae Fructus (top)
- 09:54, 7 October 2016 (diff | hist) . . (+6) . . CrudeDrug:Cyperi Rhizoma (top)
- 09:52, 7 October 2016 (diff | hist) . . (-45) . . CrudeDrug:Carthami Flos (top)
- 09:51, 7 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Koi (top)
- 09:49, 7 October 2016 (diff | hist) . . (0) . . CrudeDrug:Cinnamomi Cortex (top)
- 09:46, 7 October 2016 (diff | hist) . . (+21) . . CrudeDrug:Notopterygii Rhizoma
- 09:45, 7 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Chrysanthemi Flos (top)
- 10:34, 4 October 2016 (diff | hist) . . (+2) . . CrudeDrug:Asini Corii Collas (top)
- 11:44, 3 October 2016 (diff | hist) . . (-36) . . CrudeDrug:Nelumbis Semen (top)
- 11:42, 3 October 2016 (diff | hist) . . (-3) . . CrudeDrug:Forsythiae Fructus
- 11:40, 3 October 2016 (diff | hist) . . (-114) . . CrudeDrug:Alpiniae officinari Rhizoma
- 11:39, 3 October 2016 (diff | hist) . . (-42) . . CrudeDrug:Gentianae scabrae Radix (top)
- 11:37, 3 October 2016 (diff | hist) . . (+30) . . CrudeDrug:Fossilia Ossis Mastodi (top)
- 11:34, 3 October 2016 (diff | hist) . . (-18) . . CrudeDrug:Longan Arillus (top)
- 11:31, 3 October 2016 (diff | hist) . . (+51) . . CrudeDrug:Coicis Semen
- 11:28, 3 October 2016 (diff | hist) . . (-39) . . CrudeDrug:Leonuri Herba
- 11:27, 3 October 2016 (diff | hist) . . (-106) . . CrudeDrug:Saussureae Radix (top)
- 11:24, 3 October 2016 (diff | hist) . . (-60) . . CrudeDrug:Akebiae Caulis
- 11:21, 3 October 2016 (diff | hist) . . (-10) . . CrudeDrug:Mel (top)
- 11:19, 3 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Mel
- 11:12, 3 October 2016 (diff | hist) . . (-69) . . CrudeDrug:Cannabis Fructus (top)
- 11:10, 3 October 2016 (diff | hist) . . (+39) . . CrudeDrug:Ephedrae Herba (top)
- 11:06, 3 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Ostreae Testa (top)
- 10:57, 3 October 2016 (diff | hist) . . (+15) . . CrudeDrug:Moutan Cortex
- 10:51, 3 October 2016 (diff | hist) . . (+30) . . CrudeDrug:Saposhnikoviae Radix (top)
- 10:47, 3 October 2016 (diff | hist) . . (+25) . . CrudeDrug:Natrii Sulfus (top)
- 10:41, 3 October 2016 (diff | hist) . . (-49) . . CrudeDrug:Sinomeni Caulis et Rhizoma (top)
- 10:39, 3 October 2016 (diff | hist) . . (+54) . . CrudeDrug:Processi Aconiti Radix
- 10:33, 3 October 2016 (diff | hist) . . (-75) . . CrudeDrug:Poria (top)
- 10:30, 3 October 2016 (diff | hist) . . (-63) . . CrudeDrug:Arecae Semen (top)
- 10:24, 3 October 2016 (diff | hist) . . (-3) . . CrudeDrug:Eriobotryae Folium
- 10:19, 3 October 2016 (diff | hist) . . (+9) . . CrudeDrug:Angelicae dahuricae Radix (top)
- 10:17, 3 October 2016 (diff | hist) . . (-27) . . CrudeDrug:Lilii Bulbus (top)
- 10:15, 3 October 2016 (diff | hist) . . (-54) . . CrudeDrug:Pinelliae Tuber (top)
- 10:10, 3 October 2016 (diff | hist) . . (-57) . . CrudeDrug:Menthae Herba
- 10:07, 3 October 2016 (diff | hist) . . (-54) . . CrudeDrug:Ophiopogonis Tuber (top)
- 10:02, 3 October 2016 (diff | hist) . . (+25) . . CrudeDrug:Hordei Fructus Germinatus (top)
- 10:00, 3 October 2016 (diff | hist) . . (-9) . . CrudeDrug:Fritillariae Bulbus
- 09:58, 3 October 2016 (diff | hist) . . (-45) . . CrudeDrug:Lonicerae Folium cum Caulis (top)
- 09:53, 3 October 2016 (diff | hist) . . (-255) . . CrudeDrug:Ginseng Radix (top)
- 09:50, 3 October 2016 (diff | hist) . . (+33) . . CrudeDrug:Eucommiae Cortex (top)
- 09:48, 3 October 2016 (diff | hist) . . (+18) . . CrudeDrug:Aralia cordata Rhizoma
- 09:43, 3 October 2016 (diff | hist) . . (-33) . . CrudeDrug:Persicae Semen
- 15:30, 30 September 2016 (diff | hist) . . (+66) . . CrudeDrug:Angelicae Radix
- 15:25, 30 September 2016 (diff | hist) . . (-27) . . CrudeDrug:Benincasae Semen
- 15:07, 30 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Asparagi Tuber (top)
- 15:03, 30 September 2016 (diff | hist) . . (0) . . CrudeDrug:Gastrodiae Tuber (top)
- 14:40, 30 September 2016 (diff | hist) . . (+25) . . CrudeDrug:Arisaematis Rhizoma (top)
- 14:15, 30 September 2016 (diff | hist) . . (+15) . . CrudeDrug:Aurantii Nobilis Pericarpium (top)
- 14:13, 30 September 2016 (diff | hist) . . (-33) . . CrudeDrug:Polyporus (top)
- 14:10, 30 September 2016 (diff | hist) . . (-21) . . CrudeDrug:Uncariae Uncis cum Ramulus (top)
- 14:06, 30 September 2016 (diff | hist) . . (-102) . . CrudeDrug:Caryophylli Flos (top)
- 14:02, 30 September 2016 (diff | hist) . . (+19) . . CrudeDrug:Camelliae Folium (top)
- 13:56, 30 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Anemarrhenae Rhizoma (top)
- 13:51, 30 September 2016 (diff | hist) . . (-90) . . CrudeDrug:Alismatis Rhizoma (top)
- 13:45, 30 September 2016 (diff | hist) . . (-72) . . CrudeDrug:Zizyphi Fructus (top)
- 13:37, 30 September 2016 (diff | hist) . . (-72) . . CrudeDrug:Rhei Rhizoma (top)
- 13:31, 30 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Perillae Herba
- 13:25, 30 September 2016 (diff | hist) . . (-15) . . CrudeDrug:Sappan Lignum
- 13:22, 30 September 2016 (diff | hist) . . (-21) . . CrudeDrug:Mori Cortex (top)
- 13:16, 30 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Atractylodis Rhizoma (top)
- 13:12, 30 September 2016 (diff | hist) . . (+6) . . CrudeDrug:Atractylodis lanceae Rhizoma (top)
- 10:45, 30 September 2016 (diff | hist) . . (+55) . . CrudeDrug:Cicadae Periostracum (top)
- 10:42, 30 September 2016 (diff | hist) . . (+21) . . CrudeDrug:Nupharis Rhizoma
- 10:38, 30 September 2016 (diff | hist) . . (+9) . . CrudeDrug:Peucedani Radix (top)
- 10:34, 30 September 2016 (diff | hist) . . (+45) . . CrudeDrug:Cnidii Rhizoma
- 09:53, 30 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Gypsum Fibrosum (top)
- 09:49, 30 September 2016 (diff | hist) . . (+18) . . CrudeDrug:Oryzae Fructus
- 09:47, 30 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Oryzae Fructus
- 14:29, 28 September 2016 (diff | hist) . . (+27) . . CrudeDrug:Magnoliae Flos (top)
- 14:13, 28 September 2016 (diff | hist) . . (+24) . . CrudeDrug:Cimicifugae Rhizoma
- 13:56, 28 September 2016 (diff | hist) . . (-33) . . CrudeDrug:Zingiberis Rhizoma
- 13:51, 28 September 2016 (diff | hist) . . (-39) . . CrudeDrug:Zingiberis Processum Rhizoma
- 13:49, 28 September 2016 (diff | hist) . . (-117) . . CrudeDrug:Zingiberis Rhizoma
- 13:38, 28 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Amomi Semen (top)
- 13:35, 28 September 2016 (diff | hist) . . (-15) . . CrudeDrug:Plantaginis Semen (top)
- 13:32, 28 September 2016 (diff | hist) . . (-135) . . CrudeDrug:Paeoniae Radix
- 13:30, 28 September 2016 (diff | hist) . . (-75) . . CrudeDrug:Tribuli Fructus (top)
- 13:28, 28 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Lithospermi Radix (top)
- 13:25, 28 September 2016 (diff | hist) . . (-18) . . CrudeDrug:Lycii Cortex (top)
- 13:23, 28 September 2016 (diff | hist) . . (-102) . . CrudeDrug:Rehmanniae Radix (top)
- 13:20, 28 September 2016 (diff | hist) . . (-66) . . CrudeDrug:Dioscoreae Rhizoma (top)
- 13:17, 28 September 2016 (diff | hist) . . (-39) . . CrudeDrug:Zizyphi Semen (top)
- 15:23, 26 September 2016 (diff | hist) . . (-45) . . CrudeDrug:Zanthoxyli Fructus (top)
- 15:21, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Corni Fructus (top)
- 15:20, 26 September 2016 (diff | hist) . . (+33) . . CrudeDrug:Gardeniae Fructus (top)
- 15:12, 26 September 2016 (diff | hist) . . (-30) . . CrudeDrug:Crataegi Fructus
- 15:11, 26 September 2016 (diff | hist) . . (+54) . . CrudeDrug:Crocus
- 15:09, 26 September 2016 (diff | hist) . . (-27) . . CrudeDrug:Asiasari Radix
- 15:06, 26 September 2016 (diff | hist) . . (+9) . . CrudeDrug:Bupleuri Radix
- 14:59, 26 September 2016 (diff | hist) . . (-150) . . CrudeDrug:Schisandrae Fructus (top)
- 14:56, 26 September 2016 (diff | hist) . . (0) . . CrudeDrug:Sesami Semen (top)
- 14:55, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Arctii Fructus (top)
- 14:52, 26 September 2016 (diff | hist) . . (-57) . . CrudeDrug:Evodiae Fructus
- 14:49, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Achyranthis Radix
- 14:46, 26 September 2016 (diff | hist) . . (-105) . . CrudeDrug:Magnoliae Cortex (top)
- 14:44, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Oryzae Fructus
- 14:42, 26 September 2016 (diff | hist) . . (-15) . . CrudeDrug:Cyperi Rhizoma
- 14:39, 26 September 2016 (diff | hist) . . (+3) . . CrudeDrug:Carthami Flos
- 14:32, 26 September 2016 (diff | hist) . . (-54) . . CrudeDrug:Koi
- 14:27, 26 September 2016 (diff | hist) . . (-141) . . CrudeDrug:Cinnamomi Cortex
- 14:22, 26 September 2016 (diff | hist) . . (-27) . . CrudeDrug:Schizonepetae Spica
- 14:20, 26 September 2016 (diff | hist) . . (-22) . . CrudeDrug:Sophorae Radix (top)
- 14:16, 26 September 2016 (diff | hist) . . (-63) . . CrudeDrug:Armeniacae Semen (top)
- 14:13, 26 September 2016 (diff | hist) . . (-66) . . CrudeDrug:Notopterygii Rhizoma
- 14:07, 26 September 2016 (diff | hist) . . (-147) . . CrudeDrug:Aurantii Fructus Immaturus (top)
- 14:05, 26 September 2016 (diff | hist) . . (-60) . . CrudeDrug:Chrysanthemi Flos
- 14:03, 26 September 2016 (diff | hist) . . (-117) . . CrudeDrug:Platycodi Radix (top)
- 13:56, 26 September 2016 (diff | hist) . . (+42) . . CrudeDrug:Glycyrrhizae Radix (top)
- 13:52, 26 September 2016 (diff | hist) . . (+34) . . CrudeDrug:Trichosanthis Semen (top)
- 13:49, 26 September 2016 (diff | hist) . . (-54) . . CrudeDrug:Trichosanthis Radix (top)
- 13:46, 26 September 2016 (diff | hist) . . (-9) . . CrudeDrug:Kasseki (top)
- 13:43, 26 September 2016 (diff | hist) . . (-72) . . CrudeDrug:Puerariae Radix (top)
- 13:41, 26 September 2016 (diff | hist) . . (-63) . . CrudeDrug:Polygoni multiflori Radix (top)
- 13:38, 26 September 2016 (diff | hist) . . (+25) . . CrudeDrug:Artemisiae Folium (top)
- 13:33, 26 September 2016 (diff | hist) . . (0) . . Persist:CrudeDrugList
- 13:33, 26 September 2016 (diff | hist) . . (+118) . . Persist:CrudeDrugList
- 13:44, 20 September 2016 (diff | hist) . . (-36) . . CrudeDrug:Polygalae Radix (top)
- 13:41, 20 September 2016 (diff | hist) . . (-102) . . CrudeDrug:Coptidis Rhizoma (top)
- 13:35, 20 September 2016 (diff | hist) . . (-21) . . CrudeDrug:Quercus Cortex (top)
- 13:30, 20 September 2016 (diff | hist) . . (-3) . . CrudeDrug:Asini Corii Collas
- 13:27, 20 September 2016 (diff | hist) . . (0) . . CrudeDrug:Pruni Cortex (top)
- 13:16, 20 September 2016 (diff | hist) . . (+16) . . CrudeDrug:Pruni Cortex
- 13:14, 20 September 2016 (diff | hist) . . (-36) . . CrudeDrug:Phellodendri Cortex (top)
- 11:32, 20 September 2016 (diff | hist) . . (-162) . . CrudeDrug:Scutellariae Radix (top)
- 11:28, 20 September 2016 (diff | hist) . . (-135) . . CrudeDrug:Astragali Radix (top)
- 11:25, 20 September 2016 (diff | hist) . . (+15) . . CrudeDrug:Corydalis Tuber (top)
- 11:20, 20 September 2016 (diff | hist) . . (-84) . . CrudeDrug:Linderae Radix (top)
- 11:18, 20 September 2016 (diff | hist) . . (-84) . . CrudeDrug:Foeniculi Fructus (top)
- 11:14, 20 September 2016 (diff | hist) . . (+17) . . CrudeDrug:Asini Corii Collas
- 11:10, 20 September 2016 (diff | hist) . . (-153) . . CrudeDrug:Artemisiae capillaris Flos (top)
- 11:01, 20 September 2016 (diff | hist) . . (-14) . . CrudeDrug:Asini Corii Collas
- 11:01, 20 September 2016 (diff | hist) . . (+16) . . CrudeDrug:Asini Corii Collas
- 10:01, 20 September 2016 (diff | hist) . . (+30) . . CrudeDrug:Clematidis Radix (top)
- 01:33, 4 July 2015 (diff | hist) . . (0) . . User:Aritalab/Kazuhiro Takemoto (top)
- 01:32, 4 July 2015 (diff | hist) . . (+9) . . User:Aritalab/Kazuhiro Takemoto
- 01:31, 4 July 2015 (diff | hist) . . (+77) . . User:Aritalab/Kazuhiro Takemoto
- 15:05, 31 December 2014 (diff | hist) . . (+381) . . N SNP:Test (Created page with "@HD VN:1.5 SO:coordinate @SQ SN:test LN:45 r001 163 test 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG * r002 0 test 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA * r003 0 test 9 30 5S6M *...") (top)
- 14:42, 31 December 2014 (diff | hist) . . (+92) . . N JBrowseTest (Created page with "{{#includejs:JBrowse.js|Test}} <div id="GenomeBrowser" style="width: 600px; height: 400px">") (top)
- 14:34, 31 December 2014 (diff | hist) . . (+381) . . N SAM:Test (Created page with "@HD VN:1.5 SO:coordinate @SQ SN:test LN:45 r001 163 test 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG * r002 0 test 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA * r003 0 test 9 30 5S6M *...") (top)
- 14:31, 31 December 2014 (diff | hist) . . (+51) . . N FASTA:Test (Created page with ">test AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT") (top)
- 12:27, 26 September 2014 (diff | hist) . . (-9,713) . . Mol:Test (top)
- 12:27, 26 September 2014 (diff | hist) . . (0) . . File:Testn.png (Editor uploaded a new version of "File:Testn.png") (top)
- 12:27, 26 September 2014 (diff | hist) . . (0) . . File:Test.png (Editor uploaded a new version of "File:Test.png") (top)
- 17:28, 13 July 2014 (diff | hist) . . (+42) . . User:Aritalab (→{{Bilingual|過去のメンバー|Alumni}})
- 21:34, 25 March 2014 (diff | hist) . . (+82) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA)) (top)
- 21:27, 25 March 2014 (diff | hist) . . (+9) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 20:13, 25 March 2014 (diff | hist) . . (-88) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:27, 25 March 2014 (diff | hist) . . (-12) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:27, 25 March 2014 (diff | hist) . . (+100) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:24, 25 March 2014 (diff | hist) . . (+30) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:21, 25 March 2014 (diff | hist) . . (+82) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 18:19, 25 March 2014 (diff | hist) . . (+1,099) . . User:Aritalab/Yoshihiko Hasegawa (→長谷川禎彦(Yoshihiko HASEGAWA))
- 11:47, 10 February 2014 (diff | hist) . . (+78) . . Template:AtMet (top)
- 11:00, 7 February 2014 (diff | hist) . . (+474) . . N AtMet:Gamma-Tocopherol::1 (top)
- 11:00, 7 February 2014 (diff | hist) . . (+441) . . N AtMet:Gamma-Glutamyl-L-cysteine (top)
- 11:00, 7 February 2014 (diff | hist) . . (+400) . . N AtMet:Gamma-Carotene (top)
- 11:00, 7 February 2014 (diff | hist) . . (+481) . . N AtMet:Octadecanoic acid (top)
- 11:00, 7 February 2014 (diff | hist) . . (+426) . . N AtMet:Galactono-1,4-lactone (top)
- 11:00, 7 February 2014 (diff | hist) . . (+365) . . N AtMet:Epicatechin trimer (top)
- 11:00, 7 February 2014 (diff | hist) . . (+394) . . N AtMet:Fucose (top)
- 11:00, 7 February 2014 (diff | hist) . . (+406) . . N AtMet:Formylkynurenine (top)
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)